Online Inquiry
Ywhae cDNA ORF Clone, Rat, N-HA tag
SPD-00059
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide with N terminal HA tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | 14-3-3 |
Gene Abbr. | Ywhae |
Gene ID | 29753 |
Full Name | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon |
Alias | 14-3-3e |
Introduction | The 14-3-3 family of proteins plays a key regulatory role in signal transduction, checkpoint control, apoptotic and nutrient-sensing pathways. 14-3-3 proteins are highly conserved and ubiquitously expressed. There are at least seven isoforms, β, γ, ε, σ, ζ, τ, and η that have been identified in mammals. The initially described α and δ isoforms are confirmed to be phosphorylated forms of β and ζ, respectively. Through their amino-terminal α helical region, 14-3-3 proteins form homo- or heterodimers that interact with a wide variety of proteins: transcription factors, metabolic enzymes, cytoskeletal proteins, kinases, phosphatases, and other signaling molecules. The interaction of 14-3-3 proteins with their targets is primarily through a phospho-Ser/Thr motif. However, binding to divergent phospho-Ser/Thr motifs, as well as phosphorylation independent interactions has been observed. 14-3-3 binding masks specific sequences of the target protein, and therefore, modulates target protein localization, phosphorylation state, stability, and molecular interactions. 14-3-3 proteins may also induce target protein conformational changes that modify target protein function. Distinct temporal and spatial expression patterns of 14-3-3 isoforms have been observed in development and in acute response to extracellular signals and drugs, suggesting that 14-3-3 isoforms may perform different functions despite their sequence similarities. Several studies suggest that 14-3-3 isoforms are differentially regulated in cancer and neurological syndromes. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide with N terminal HA tag. |
NCBI Ref Seq | BC063163.1 |
RefSeq ORF Size | 768 bp |
Vector | pCMV3-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.