WIPI1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

WIPI1 cDNA ORF Clone, Human, untagged

WIPI1 cDNA ORF Clone, Human, untagged

SPD-15515

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human WD repeat domain, phosphoinositide interacting 1.
Target Information
Species Human
Target Name WIPI1
Gene Abbr. WIPI1
Gene ID 55062
Full Name WD repeat domain, phosphoinositide interacting 1
Alias ATG18, ATG18A, WIPI49
Product Details
Description Full length Clone DNA of Human WD repeat domain, phosphoinositide interacting 1.
NCBI Ref Seq BC039867
RefSeq ORF Size 1341 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.