Online Inquiry
ULK1 cDNA ORF Clone, Human, N-Myc tag
SPD-15377
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human unc-51-like kinase 1 (C. elegans) with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | ULK1 |
| Gene Abbr. | ULK1 |
| Gene ID | 8408 |
| Full Name | unc-51 like autophagy activating kinase 1 |
| Alias | ATG1, ATG1A, UNC51, Unc51.1, hATG1 |
| Introduction | Two related serine/threonine kinases, UNC-51-like kinase 1 and 2 (ULK1, ULK2), were discovered as mammalian homologs of the C. elegans gene UNC-51 in which mutants exhibited abnormal axonal extension and growth. Both proteins are widely expressed and contain an amino-terminal kinase domain followed by a central proline/serine rich domain and a highly conserved carboxy-terminal domain. The roles of ULK1 and ULK2 in axon growth have been linked to studies showing that the kinases are localized to neuronal growth cones and are involved in endocytosis of critical growth factors, such as NGF. Yeast two-hybrid studies found ULK1/2 associated with modulators of the endocytic pathway, SynGAP and syntenin. Structural similarity of ULK1/2 has also been recognized with the yeast autophagy protein Atg1/Apg1. Knockdown experiments using siRNA demonstrated that ULK1 is essential for autophagy a catabolic process for the degradation of bulk cytoplasmic contents. It appears that Atg1/ULK1 can act as a convergence point for multiple signals that control autophagy, and can bind to several autophagy-related (Atg) proteins, regulating phosphorylation states and protein trafficking.AMPK, activated during low nutrient conditions, directly phosphorylates ULK1 at multiple sites, including Ser317, Ser555, and Ser777. Conversely, mTOR, which is a regulator of cell growth and an inhibitor of autophagy, phosphorylates ULK1 at Ser757 and disrupts the interaction between ULK1 and AMPK. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human unc-51-like kinase 1 (C. elegans) with N terminal Myc tag. |
| NCBI Ref Seq | NM_003565.2 |
| RefSeq ORF Size | 3198 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1110C/T,2292T/C not causing the amino acid variation. |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Restriction Sites | HindIII + XbaI (6kb + 3.19kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.