ULK1 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

ULK1 cDNA ORF Clone, Human, N-FLAG tag

ULK1 cDNA ORF Clone, Human, N-FLAG tag

SPD-15375

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human unc-51-like kinase 1 (C. elegans) with N terminal Flag tag.
Target Information
Species Human
Target Name ULK1
Gene Abbr. ULK1
Gene ID 8408
Full Name unc-51 like autophagy activating kinase 1
Alias ATG1, ATG1A, UNC51, Unc51.1, hATG1
Introduction Two related serine/threonine kinases, UNC-51-like kinase 1 and 2 (ULK1, ULK2), were discovered as mammalian homologs of the C. elegans gene UNC-51 in which mutants exhibited abnormal axonal extension and growth. Both proteins are widely expressed and contain an amino-terminal kinase domain followed by a central proline/serine rich domain and a highly conserved carboxy-terminal domain. The roles of ULK1 and ULK2 in axon growth have been linked to studies showing that the kinases are localized to neuronal growth cones and are involved in endocytosis of critical growth factors, such as NGF. Yeast two-hybrid studies found ULK1/2 associated with modulators of the endocytic pathway, SynGAP and syntenin. Structural similarity of ULK1/2 has also been recognized with the yeast autophagy protein Atg1/Apg1. Knockdown experiments using siRNA demonstrated that ULK1 is essential for autophagy a catabolic process for the degradation of bulk cytoplasmic contents. It appears that Atg1/ULK1 can act as a convergence point for multiple signals that control autophagy, and can bind to several autophagy-related (Atg) proteins, regulating phosphorylation states and protein trafficking.AMPK, activated during low nutrient conditions, directly phosphorylates ULK1 at multiple sites, including Ser317, Ser555, and Ser777. Conversely, mTOR, which is a regulator of cell growth and an inhibitor of autophagy, phosphorylates ULK1 at Ser757 and disrupts the interaction between ULK1 and AMPK.
Product Details
Description Full length Clone DNA of Human unc-51-like kinase 1 (C. elegans) with N terminal Flag tag.
NCBI Ref Seq NM_003565.2
RefSeq ORF Size 3192 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1149C/T,2331T/C not causing the amino acid variation.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites HindIII + XbaI (6kb + 3.19kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.