Online Inquiry
TNFSF15 cDNA ORF Clone, Human, N-FLAG tag
SPD-14684
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 15 with N terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | TL1A |
| Gene Abbr. | TNFSF15 |
| Gene ID | 9966 |
| Full Name | TNF superfamily member 15 |
| Alias | TL1, TL1A, TNLG1B, VEGI, VEGI192A |
| Introduction | TL1A is a type II transmembrane protein belonging to the TNF superfamily and has been designated TNF superfamily member 15 (TNFSF15). Human TL1A is a 251 aa protein consisting of a 35 aa cytoplasmic domain, a 24 aa transmembrane region and a 192 aa C-terminal extracellular domain. It is a longer variant of the previously cloned TL1 (also known as VEGI) that is possibly a cloning artifact. TL1A is predominantly expressed in endothelial cells and its expression is inducible by TNF-alpha and IL-1 alpha. TL1A binds with high affinity to death receptor 3 (DR3), which is now designated TNF receptor superfamily member 25 (TNFRSF25). DR3 was formerly designated TNFRSF12 when it was thought to be the receptor for TWEAK/TNFSF12. DR3 is expressed primarily on activated T cells. Depending on the cell context, ligation of DR3 by TL1A can trigger one of two signaling pathways, activation of the transcription factor NF-kappa-B or activation of caspases and apoptosis. On primary T cells, TL1A induces NF-kappa-B activation and a costimulatory signal to increase IL-2 responsiveness and the secretion of proinflammatory cytokines. However, in a tumor cell line, TF-1, TL1A has been shown to induce caspase activity and apoptosis. These effects of TL1A are blocked by the secreted, soluble decoy receptor 3 (DcR3), also known as TR6 and TNFRSF6B, which compete with DR3 for binding to TL1A. Consistent with the observed in vitro activities, TL1A promotes ex vivo splenocyte expansion and enhances in vivo graft-versus-host-response. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human tumor necrosis factor (ligand) superfamily, member 15 with N terminal Flag tag. |
| NCBI Ref Seq | NM_005118.3 |
| RefSeq ORF Size | 756 bp |
| Vector | pCMV3-SP-N-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.