Online Inquiry
Tnfsf11 cDNA ORF Clone, Mouse, C-His tag
SPD-15257
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 11 with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | TRANCE |
| Gene Abbr. | Tnfsf11 |
| Gene ID | 21943 |
| Full Name | tumor necrosis factor (ligand) superfamily, member 11 |
| Alias | Ly10, Ly109l, O, OD, ODF |
| Introduction | TRANCE/OPGL/RANKL/ODF is a recently identified member of tumor necrosis factor family. TRANCE (TNF-related activation-induced cytokine receptor) or RANKL {receptor activator of NF-kB (RANK) ligand} has been implicated in interactions between T cells and dendritic cells. RANK ligand (RANKL/TRANCE) binds to RANK on dendritic cells, upregulates the expression of anti-apoptotic protein BcL-XL suggesting a role in dendritic cell survival. TRANCE/RANKL is also important in T and B-cell maturation. As OPGL/ODF (Osteoprotegerin Ligand/Osteoclast differentiation factor), the same protein can both activate mature osteoclasts and mediate osteoclastogenesis. OPGL/TRANCE deficient mice show severe osteoporesis and complete absence of osteoclasts as a result of lack of osteogenesis. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 11 with C terminal His tag. |
| NCBI Ref Seq | NM_011613.3 |
| RefSeq ORF Size | 996 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 342C/A not causing the amino acid variation. |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Restriction Sites | HindIII + NotI (6kb + 1kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.