Online Inquiry
Tnfsf10 cDNA ORF Clone, Mouse, C-HA tag
SPD-15177
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 10 with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | TRAIL |
| Gene Abbr. | Tnfsf10 |
| Gene ID | 22035 |
| Full Name | tumor necrosis factor (ligand) superfamily, member 10 |
| Alias | A330042I21Rik, AI448571, AP, APO-2L, Ly81 |
| Introduction | Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL), also referred to as Apo2 ligand, first identified based on its sequence homology to TNF and Fas/Apo ligand is a member of the TNF family of cytokines and either exists as a type II membrane or soluble protein. TRAIL induces apoptosis in a variety of transformed cell lines and plays a role in anti-tumor and anti-viral immune surveillance. TRAIL signals via binding with death receptors DR4 (TRAIL-R1) and DR5 (TRAIL-R2) which can trigger apoptosis as well as NF-κB activation. Death domains on these receptors leads to the recruitment of a death-induced signaling complex (DISC) leading to caspase-8 and subsequent caspase-3 activation. In addition, TRAIL binds with decoy receptors DcR1 (TRAIL-R3) and DcR2 (TRAIL-R4, TRUNDD) which lack the functional cytoplasmic death domain antagonizing TRAIL-induced apoptosis. Osteoprotegerin (OPG) has also been identified as receptor capable of inhibiting TRAIL-induced apoptosis. The selectivity of soluble TRAIL at triggering apoptosis in transformed cells as compared to normal cells has led to its investigation as a potential cancer therapeutic. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 10 with C terminal HA tag. |
| NCBI Ref Seq | NM_009425.2 |
| RefSeq ORF Size | 876 bp |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.