Online Inquiry
TLE1 cDNA ORF Clone, Human, untagged
SPD-14708
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila). |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | TLE1 |
| Gene Abbr. | TLE1 |
| Gene ID | 7088 |
| Full Name | TLE family member 1, transcriptional corepressor |
| Alias | ESG, ESG1, GRG1 |
| Introduction | Transducin-like enhancer of split proteins (TLE1, TLE2, TLE3, TLE4, and TLE6) are mammalian homologs of Drosophila Groucho. TLEs contain several WD-repeats implicated in protein-protein interaction. TLEs are transcriptional co-repressors that bind to many transcription factors such as LEF1, Runx1, Oct-1, hepatocyte nuclear factor 3-β as well as histone H3. TLEs are differentially expressed during animal development and may have overlapping as well as distinct functions. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila). |
| NCBI Ref Seq | NM_005077.3 |
| RefSeq ORF Size | 2313 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the mutation 354 A/G not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + XbaI (6.1kb + 2.31kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.