Online Inquiry
TF cDNA ORF Clone, Human, N-HA tag
SPD-15294
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human transferrin with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Transferrin |
| Gene Abbr. | TF |
| Gene ID | 7018 |
| Full Name | transferrin |
| Alias | HEL-S-71p, PRO1557, PRO2086, TFQTL1 |
| Introduction | Transferrin is a single polypeptide chain glycoprotein and is a member of the iron binding family of proteins. It has a molecular weight of 77 kDa and a serum concentration range of 1800 to 2700 mg/L. It is synthesised in the liver and consists of two domains each having a high affinity reversible binding site for Fe3+. The iron is transported in blood and interstitial fluids to sites of use and disposal. Iron/transferrin is essential in haemoglobin synthesis and for certain types of cell division. Serum concentration rises in iron deficiency and pregnancy and falls in iron overload, infection and inflammatory conditions. The function of transferrin is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. In addition to its function in iron transport, this protein may also have a physiologic role as granulocyte/pollen binding protein (GPBP) involved in the removal of certain organic matter/allergins from serum. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human transferrin with N terminal HA tag. |
| NCBI Ref Seq | NM_001063.2 |
| RefSeq ORF Size | 2130 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 772C/T not causing the amino acid variation. |
| Vector | pCMV3-SP-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI (two restriction sites) + XbaI (6kb + 1.79kb + 0.34kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.