Online Inquiry
TANK cDNA ORF Clone, Human, C-FLAG tag
SPD-14411
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human TRAF family member-associated NFKB activator with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | TANK |
| Gene Abbr. | TANK |
| Gene ID | 10010 |
| Full Name | TRAF family member associated NFKB activator |
| Alias | I-TRAF, ITRAF, TRAF2 |
| Introduction | TRAF (tumor necrosis factor receptor-associated factor) family member-associated NF-kappaB activator (TANK) maintains TRAF1, TRAF2 and TRAF3 proteins in their latent states (cytoplasmic sequestration). TANK binds to their TRAF-c domains inhibiting TRAF signaling and NF kappa B activation. TANK may function as an adaptor molecule in multiple antiviral pathways. Two transcript variants encoding different isoforms for this gene have been found. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human TRAF family member-associated NFKB activator with C terminal Flag tag. |
| NCBI Ref Seq | NM_004180.2 |
| RefSeq ORF Size | 1317 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 1.32kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.