Online Inquiry
Stat5b cDNA ORF Clone, Mouse, untagged
SPD-14167
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse signal transducer and activator of transcription 5B. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Stat5 |
| Gene Abbr. | Stat5b |
| Gene ID | 20851 |
| Full Name | signal transducer and activator of transcription 5B |
| Introduction | Stat5 is activated in response to a wide variety of ligands including IL-2, GM-CSF, growth hormone and prolactin. Phosphorylation at Tyr694 is obligatory for Stat5 activation. This phosphorylation is mediated by Src upon erythropoietin stimulation. Stat5 is constitutively active in some leukemic cell types. Phosphorylated Stat5 is found in some endothelial cells treated with IL-3, which suggests its involvement in angiogenesis and cell motility. Stat5a and Stat5b are independently regulated and activated in various cell types. For instance, interferon treatment predominantly activates Stat5a in U-937 cells and Stat5b in HeLa cells. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse signal transducer and activator of transcription 5B. |
| NCBI Ref Seq | NM_001113563.1 |
| RefSeq ORF Size | 2361 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6kb + 2.36kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.