STAT4 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

STAT4 cDNA ORF Clone, Human, untagged

STAT4 cDNA ORF Clone, Human, untagged

SPD-14137

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human signal transducer and activator of transcription 4
Target Information
Species Human
Target Name Stat4
Gene Abbr. STAT4
Gene ID 6775
Full Name signal transducer and activator of transcription 4
Alias SLEB11
Product Details
Description Full length Clone DNA of Human signal transducer and activator of transcription 4
NCBI Ref Seq NM_001243835.1
RefSeq ORF Size 2247 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Restriction Sites KpnI + NotI (6.1kb + 2.25kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.