Srsf1 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Srsf1 cDNA ORF Clone, Mouse, untagged

Srsf1 cDNA ORF Clone, Mouse, untagged

SPD-14085

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse serine/arginine-rich splicing factor 1.
Target Information
Species Mouse
Target Name SRSF1
Gene Abbr. Srsf1
Gene ID 110809
Full Name serine and arginine-rich splicing factor 1
Alias 1110054N12Rik, 5730507C05Rik, 6330415C05Rik, AI482334, AW491331
Product Details
Description Full length Clone DNA of Mouse serine/arginine-rich splicing factor 1.
NCBI Ref Seq NM_173374.4
RefSeq ORF Size 747 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.