Online Inquiry
SPTAN1 cDNA ORF Clone, Human, untagged
SPD-15758
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human spectrin, alpha, non-erythrocytic 1 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | α-Fodrin |
| Gene Abbr. | SPTAN1 |
| Gene ID | 6709 |
| Full Name | spectrin alpha, non-erythrocytic 1 |
| Alias | DEE5, EIEE5, NEAS, SPTA2 |
| Introduction | Fodrin (also named nonerythroid spectrin) is a universally expressed membrane-associated cytoskeletal protein consisting of alpha- and beta-subunits. This protein is important for maintaining normal membrane structure and supporting cell surface protein function. Alpha-fodrin is one of the primary targets cleaved by caspases during apoptosis. The full length 240 kDa protein can be cleaved at several sites within its sequence by activated caspases to yield amino-terminal 150 kDa, carboxy-terminal 120 kDa and 35 kDa major products. Cleavage of alpha-fodrin leads to membrane malfunction and cell shrinkage. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human spectrin, alpha, non-erythrocytic 1 |
| NCBI Ref Seq | NM_001130438.2 |
| RefSeq ORF Size | 7434 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.