Online Inquiry
SOCS6 cDNA ORF Clone, Human, C-His tag
SPD-14025
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human suppressor of cytokine signaling 6 with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | SOCS6 |
| Gene Abbr. | SOCS6 |
| Gene ID | 9306 |
| Full Name | suppressor of cytokine signaling 6 |
| Alias | CIS-4, CIS4, HSPC060, SOCS-4, SOCS-6 |
| Introduction | The protein encoded by this gene contains a SH2 domain and a CIS homolog domain. The protein thus belongs to the cytokine-induced STAT inhibitor (CIS), also known as suppressor of cytokine signaling (SOCS) or STAT-induced STAT inhibitor (SSI), protein family. CIS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by GM-CSF and EPO in hematopoietic cells. A high expression level of this gene was found in factor-independent chronic myelogenous leukemia (CML) and erythroleukemia (HEL) cell lines. [provided by RefSeq] |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human suppressor of cytokine signaling 6 with C terminal His tag. |
| NCBI Ref Seq | NM_004232.3 |
| RefSeq ORF Size | 1608 bp |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.