Online Inquiry
Socs2 cDNA ORF Clone, Mouse, N-Myc tag
SPD-13973
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse suppressor of cytokine signaling 2 with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | SOCS2 |
| Gene Abbr. | Socs2 |
| Gene ID | 216233 |
| Full Name | suppressor of cytokine signaling 2 |
| Alias | 8030460M17, AI527257, AW108012, CI, CIS2 |
| Introduction | The suppressor of cytokine signaling (SOCS) family members are negative regulators of cytokine signal transduction that inhibit the Jak/Stat pathway. The SOCS family consists of at least 8 members including the originally identified cytokine-inducible SH2-containing protein (CIS1), as well as SOCS1-7. Each SOCS family member contains a central SH2 domain and a conserved carboxy-terminal motif designated as the SOCS box. These proteins are important regulators of cytokine signaling, proliferation, differentiation, and immune responses.Activity of SOCS2 has been predominantly linked to growth hormone (GH) and insulin-like growth factor 1 (IGF-1) signaling but may also contribute to several biological processes including metabolism, bone formation, neuronal development, cancer, infection and other cytokine-dependent pathways. SOCS2 is widely expressed in adult and fetal tissues and is induced upon cytokine treatment. A number of studies suggest that SOCS2 can have either a positive or negative effect on GH/cytokine signaling. Mice deficient in SOCS2 grow signficantly larger than normal littermates. SOCS2 binds to tyrosine-phosphorylated GH and IGF-1 receptors via its SH2 domain, suppressing their signaling. In addition, the SOCS box of SOCS2 binds to Elongin B and C leading to activity as a ubiquitin ligase, promoting the degradation of the receptors as well as other SOCS family members. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse suppressor of cytokine signaling 2 with N terminal Myc tag. |
| NCBI Ref Seq | NM_007706.4 |
| RefSeq ORF Size | 597 bp |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.