SIRT4 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

SIRT4 cDNA ORF Clone, Human, untagged

SIRT4 cDNA ORF Clone, Human, untagged

SPD-13706

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae).
Target Information
Species Human
Target Name SirT4
Gene Abbr. SIRT4
Gene ID 23409
Full Name sirtuin 4
Alias SIR2L4
Product Details
Description Full length Clone DNA of Human sirtuin (silent mating type information regulation 2 homolog) 4 (S. cerevisiae).
NCBI Ref Seq NM_012240.2
RefSeq ORF Size 945 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.95kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.