Rorc cDNA ORF Clone, Rat, C-FLAG tag - CD BioSciences

service-banner

Rorc cDNA ORF Clone, Rat, C-FLAG tag

Rorc cDNA ORF Clone, Rat, C-FLAG tag

SPD-13454

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat RAR-related orphan receptor C with C terminal Flag tag.
Target Information
Species Rat
Target Name RORγ
Gene Abbr. Rorc
Gene ID 368158
Full Name RAR-related orphan receptor C
Introduction ROR gamma, a NR1 Thyroid Hormone-Like receptor, has been shown to affect thymopoiesis, bone metabolism, T-cell apoptosis, and lymphoid organogenesis. ROR gamma has been shown to promote thymocyte survival by activating the expression of the antiapoptotic protein Bcl-x(L). ROR gamma is also required for the development of lymph nodes and Peyer's patches. It has been shown that ROR gamma t, a thymus-specific isoform of ROR gamma from mouse, inhibits Fas ligand expression and cytokine secretion in immature thymocytes. ROR gamma binds as a monomer to response elements composed of a single core motif, GGTCA, preceded by a 6 bp AT-rich sequence. ROR gamma expression has been documented in mouse thymus, adipose, bone, skeletal muscle, liver, and kidney, and in human skeletal muscle.
Product Details
Description Full length Clone DNA of Rat RAR-related orphan receptor C with C terminal Flag tag.
NCBI Ref Seq XM_006232926.1
RefSeq ORF Size 1617 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.