Online Inquiry
RORC cDNA ORF Clone, Human, untagged
SPD-13474
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human RAR-related orphan receptor C. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | RORγ |
| Gene Abbr. | RORC |
| Gene ID | 6097 |
| Full Name | RAR related orphan receptor C |
| Alias | IMD42, NR1F3, RORG, RZR-GAMMA, RZRG |
| Introduction | ROR gamma, a NR1 Thyroid Hormone-Like receptor, has been shown to affect thymopoiesis, bone metabolism, T-cell apoptosis, and lymphoid organogenesis. ROR gamma has been shown to promote thymocyte survival by activating the expression of the antiapoptotic protein Bcl-x(L). ROR gamma is also required for the development of lymph nodes and Peyer's patches. It has been shown that ROR gamma t, a thymus-specific isoform of ROR gamma from mouse, inhibits Fas ligand expression and cytokine secretion in immature thymocytes. ROR gamma binds as a monomer to response elements composed of a single core motif, GGTCA, preceded by a 6 bp AT-rich sequence. ROR gamma expression has been documented in mouse thymus, adipose, bone, skeletal muscle, liver, and kidney, and in human skeletal muscle. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human RAR-related orphan receptor C. |
| NCBI Ref Seq | NM_001001523.1 |
| RefSeq ORF Size | 1494 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.50kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.