Online Inquiry
ROCK2 cDNA ORF Clone, Human, C-Myc tag
SPD-13441
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human Rho associated coiled-coil containing protein kinase 2 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | ROCK2 |
| Gene Abbr. | ROCK2 |
| Gene ID | 9475 |
| Full Name | Rho associated coiled-coil containing protein kinase 2 |
| Alias | ROCK-II |
| Introduction | ROCK (Rho-associated kinase), a family of serine/threonine kinases, is an important downstream target of Rho-GTPase and plays an important role in Rho-mediated signaling. Two isoforms of ROCK have been identified: ROCK1 and ROCK2. ROCK is composed of N-terminal catalytic, coiled-coil, and C-terminal PH (pleckstrin homology) domains. The C-terminus of ROCK negatively regulates its kinase activity. Caspase-3-induced cleavage of ROCK1 and direct cleavage of ROCK2 by granzyme B (grB) activates ROCK and leads to phosphorylation of myosin light chain and inhibition of myosin phosphatase. This phosphorylation may account for the mechanism by which Rho regulates cytokinesis, cell motility, cell membrane blebbing during apoptosis, and smooth muscle contraction. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human Rho associated coiled-coil containing protein kinase 2 |
| NCBI Ref Seq | BC111801 |
| RefSeq ORF Size | 2157 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Restriction Sites | KpnI + XbaI (6kb + 2.16kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.