Online Inquiry
ROCK1 Knockout Cell Line
SPL-03075
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | ROCK |
| Gene Abbr. | ROCK1 |
| Gene ID | 6093 |
| Full Name | Rho associated coiled-coil containing protein kinase 1 |
| Alias | P160ROCK, ROCK-I |
| Species | Human |
| Genomic Locus | chr18:21110827 |
| Transcript | NM_005406 |
| WT Expression Level | 9.68 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein serine/threonine kinase that is activated when bound to the GTP-bound form of Rho. The small GTPase Rho regulates formation of focal adhesions and stress fibers of fibroblasts, as well as adhesion and aggregation of platelets and lymphocytes by shuttling between the inactive GDP-bound form and the active GTP-bound form. Rho is also essential in cytokinesis and plays a role in transcriptional activation by serum response factor. This protein, a downstream effector of Rho, phosphorylates and activates LIM kinase, which in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. A pseudogene, related to this gene, is also located on chromosome 18. [provided by RefSeq, Aug 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of ROCK1. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ATCCGAATTCACTTCCGATT |
| PCR Primer |
Forward: CAGAGTAGTTAGTACAGAGCCAGTC Reverse: AGGAAGTTGGTTGAAATTGCTTTCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.