Rab7a cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Rab7a cDNA ORF Clone, Rat, untagged

Rab7a cDNA ORF Clone, Rat, untagged

SPD-12838

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat RAB7A, member RAS oncogene family.
Target Information
Species Rat
Target Name RAB7A
Gene Abbr. Rab7a
Gene ID 29448
Full Name RAB7A, member RAS oncogene family
Alias Rab7
Product Details
Description Full length Clone DNA of Rat RAB7A, member RAS oncogene family.
NCBI Ref Seq NM_023950.3
RefSeq ORF Size 624 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 309A/G not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.62kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.