RAB31 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

RAB31 cDNA ORF Clone, Human, untagged

RAB31 cDNA ORF Clone, Human, untagged

SPD-12500

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human RAB31, member RAS oncogene family.
Target Information
Species Human
Target Name RAB31
Gene Abbr. RAB31
Gene ID 11031
Full Name RAB31, member RAS oncogene family
Alias Rab22B
Product Details
Description Full length Clone DNA of Human RAB31, member RAS oncogene family.
NCBI Ref Seq BC001148
RefSeq ORF Size 588 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.