Rab30 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Rab30 cDNA ORF Clone, Mouse, untagged

Rab30 cDNA ORF Clone, Mouse, untagged

SPD-12480

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse RAB30, member RAS oncogene family
Target Information
Species Mouse
Target Name RAB30
Gene Abbr. Rab30
Gene ID 75985
Full Name RAB30, member RAS oncogene family
Alias 5033421K01Rik, AI323892, Rsb30
Product Details
Description Full length Clone DNA of Mouse RAB30, member RAS oncogene family
NCBI Ref Seq NM_029494.2
RefSeq ORF Size 612 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.