PTPRK cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

PTPRK cDNA ORF Clone, Human, untagged

PTPRK cDNA ORF Clone, Human, untagged

SPD-12032

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human protein tyrosine phosphatase, receptor type, K.
Target Information
Species Human
Target Name PTPRK
Gene Abbr. PTPRK
Gene ID 5796
Full Name protein tyrosine phosphatase receptor type K
Alias R-PTP-kappa
Product Details
Description Full length Clone DNA of Human protein tyrosine phosphatase, receptor type, K.
NCBI Ref Seq NM_002844.3
RefSeq ORF Size 4323 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.