PTPRD cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

PTPRD cDNA ORF Clone, Rhesus, untagged

PTPRD cDNA ORF Clone, Rhesus, untagged

SPD-12012

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus uncharacterized LOC100424498.
Target Information
Species Rhesus
Target Name PTPRD
Gene Abbr. PTPRD
Gene ID 714954
Full Name protein tyrosine phosphatase receptor type D
Product Details
Description Full length Clone DNA of Rhesus uncharacterized LOC100424498.
NCBI Ref Seq XM_002800117.1
RefSeq ORF Size 264 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.