Online Inquiry
Ptprc cDNA ORF Clone, Mouse, N-HA tag
SPD-11981
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse protein tyrosine phosphatase, receptor type, C with N terminal HA tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | PTPRC |
Gene Abbr. | Ptprc |
Gene ID | 19264 |
Full Name | protein tyrosine phosphatase, receptor type, C |
Alias | B220, CD45R, Cd45, L-CA, Ly- |
Introduction | The protein phosphatase (PTP) receptor CD45 is a type I transmembrane protein comprised of a pair of intracellular tyrosine phosphatase domains and a variable extracellular domain generated by alternative splicing. The catalytic activity of CD45 is a function of the first phosphatase domain (D1) while the second phosphatase domain (D2) may interact with and stabilize the first domain, or recruit/bind substrates. CD45 interacts directly with antigen receptor complex proteins or activates Src family kinases involved in the regulation of T- and B-cell antigen receptor signaling. Specifically, CD45 dephosphorylates Src-family kinases Lck and Fyn at their conserved negative regulatory carboxy-terminal tyrosine residues and upregulates kinase activity. Conversely, studies indicate that CD45 can also inhibit Lck and Fyn by dephosphorylating their positive regulatory autophosphorylation site. CD45 appears to be both a positive and a negative regulator that conducts signals depending on specific stimuli and cell type. Human leukocytes including lymphocytes, eosinophils, monocytes, basophils, and neutrophils express CD45, while erythrocytes and platelets are negative for CD45 expression.Several isoforms of CD45 are generated through alternative splicing in a cell type-specific and activation state-specific manner. Memory T cells are positive for CD45RO, while naive T cells are negative for CD45RO. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse protein tyrosine phosphatase, receptor type, C with N terminal HA tag. |
NCBI Ref Seq | NM_011210.3 |
RefSeq ORF Size | 3459 bp |
Vector | pCMV3-SP-N-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.