PTPRC cDNA ORF Clone, Human, N-Myc tag - CD BioSciences

service-banner

PTPRC cDNA ORF Clone, Human, N-Myc tag

PTPRC cDNA ORF Clone, Human, N-Myc tag

SPD-12000

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human protein tyrosine phosphatase, receptor type, C transcript variant 1 with N terminal Myc tag.
Target Information
Species Human
Target Name PTPRC
Gene Abbr. PTPRC
Gene ID 5788
Full Name protein tyrosine phosphatase receptor type C
Alias B220, CD45, CD45R, GP180, L-CA
Introduction The protein phosphatase (PTP) receptor CD45 is a type I transmembrane protein comprised of a pair of intracellular tyrosine phosphatase domains and a variable extracellular domain generated by alternative splicing. The catalytic activity of CD45 is a function of the first phosphatase domain (D1) while the second phosphatase domain (D2) may interact with and stabilize the first domain, or recruit/bind substrates. CD45 interacts directly with antigen receptor complex proteins or activates Src family kinases involved in the regulation of T- and B-cell antigen receptor signaling. Specifically, CD45 dephosphorylates Src-family kinases Lck and Fyn at their conserved negative regulatory carboxy-terminal tyrosine residues and upregulates kinase activity. Conversely, studies indicate that CD45 can also inhibit Lck and Fyn by dephosphorylating their positive regulatory autophosphorylation site. CD45 appears to be both a positive and a negative regulator that conducts signals depending on specific stimuli and cell type. Human leukocytes including lymphocytes, eosinophils, monocytes, basophils, and neutrophils express CD45, while erythrocytes and platelets are negative for CD45 expression.Several isoforms of CD45 are generated through alternative splicing in a cell type-specific and activation state-specific manner. Memory T cells are positive for CD45RO, while naive T cells are negative for CD45RO.
Product Details
Description Full length Clone DNA of Human protein tyrosine phosphatase, receptor type, C transcript variant 1 with N terminal Myc tag.
NCBI Ref Seq NM_002838.4
RefSeq ORF Size 3948 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 3.95kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.