Online Inquiry
Ptk2 cDNA ORF Clone, Mouse, N-FLAG tag
SPD-05444
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse PTK2 protein tyrosine kinase 2 with N terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | FAK |
| Gene Abbr. | Ptk2 |
| Gene ID | 14083 |
| Full Name | PTK2 protein tyrosine kinase 2 |
| Alias | FA, FADK 1, FAK, FR, FRNK |
| Introduction | Focal adhesion kinase (FAK) is a widely expressed cytoplasmic protein tyrosine kinase involved in integrin-mediated signal transduction. It plays an important role in the control of several biological processes, including cell spreading, migration, and survival. Activation of FAK by integrin clustering leads to autophosphorylation at Tyr397, which is a binding site for the Src family kinases PI3K and PLCγ. Recruitment of Src family kinases results in the phosphorylation of Tyr407, Tyr576, and Tyr577 in the catalytic domain, and Tyr871 and Tyr925 in the carboxy-terminal region of FAK. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse PTK2 protein tyrosine kinase 2 with N terminal Flag tag. |
| NCBI Ref Seq | NM_007982.2 |
| RefSeq ORF Size | 3198 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 3.2kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.