Online Inquiry
Prkaca cDNA ORF Clone, Mouse, untagged
SPD-11518
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse protein kinase, cAMP dependent, catalytic, alpha. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | PKA |
| Gene Abbr. | Prkaca |
| Gene ID | 18747 |
| Full Name | protein kinase, cAMP dependent, catalytic, alpha |
| Alias | C, P, PKCD, Pk, Pkaca |
| Introduction | The second messenger cyclic AMP (cAMP) activates cAMP-dependent protein kinase (PKA or cAPK) in mammalian cells and controls many cellular mechanisms such as gene transcription, ion transport, and protein phosphorylation. Inactive PKA is a heterotetramer composed of a regulatory subunit (R) dimer and a catalytic subunit (C) dimer. In this inactive state, the pseudosubstrate sequences on the R subunits block the active sites on the C subunits. Three C subunit isoforms (C-α, C-β, and C-γ) and two families of regulatory subunits (RI and RII) with distinct cAMP binding properties have been identified. The two R families exist in two isoforms, α and β (RI-α, RI-β, RII-α, and RII-β). Upon binding of cAMP to the R subunits, the autoinhibitory contact is eased and active monomeric C subunits are released. PKA shares substrate specificity with Akt (PKB) and PKC, which are characterized by an arginine at position -3 relative to the phosphorylated serine or threonine residue. Substrates that present this consensus sequence and have been shown to be phosphorylated by PKA are Bad (Ser155), CREB (Ser133), and GSK-3 (GSK-3α Ser21 and GSK-3β Ser9). In addition, combined knock-down of PKA C-α and -β blocks cAMP-mediated phosphorylation of Raf (Ser43 and Ser259). Autophosphorylation and phosphorylation by PDK-1 are two known mechanisms responsible for phosphorylation of the C subunit at Thr197. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse protein kinase, cAMP dependent, catalytic, alpha. |
| NCBI Ref Seq | NM_008854.3 |
| RefSeq ORF Size | 1056 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 825G/A not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6kb + 1.06kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.