Online Inquiry
PPP3CC Knockout Cell Line
SPL-02765
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | Calcineurin A |
| Gene Abbr. | PPP3CC |
| Gene ID | 5533 |
| Full Name | protein phosphatase 3 catalytic subunit gamma |
| Alias | CALNA3, CNA3, PP2Bgamma |
| Species | Human |
| Genomic Locus | chr8:22475565 |
| Transcript | NM_001243975 |
| WT Expression Level | 18.71 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Calcineurin is a calcium-dependent, calmodulin-stimulated protein phosphatase involved in the downstream regulation of dopaminergic signal transduction. Calcineurin is composed of a regulatory subunit and a catalytic subunit. The protein encoded by this gene represents one of the regulatory subunits that has been found for calcineurin. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of PPP3CC. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAGAGGTAGCGTGTGTTACT |
| PCR Primer |
Forward: GTAATGCCCTTCGTCTTCTAAGGTA Reverse: AGCCTATTTGTCAGATTTTCGACTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.