PPP2R2B Knockout Cell Line - CD BioSciences

service-banner

PPP2R2B Knockout Cell Line

PPP2R2B Knockout Cell Line

SPL-02748

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name PPP2R2B
Gene Abbr. PPP2R2B
Gene ID 5521
Full Name protein phosphatase 2 regulatory subunit Bbeta
Alias B55BETA, PP2AB55BETA, PP2ABBETA, PP2APR55B, PP2APR55BETA
Species Human
Genomic Locus chr5:146701050
Transcript NM_181675
WT Expression Level 20.14 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of PPP2R2B.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence TGTAATATTTCAACGAGAGC
PCR Primer Forward: GGCAGTTTTTAGTTTTCGAGCAAAG
Reverse: GGTGGCATTTAAAACCCAGAACATA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.