Pias1 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Pias1 cDNA ORF Clone, Mouse, untagged

Pias1 cDNA ORF Clone, Mouse, untagged

SPD-11452

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse protein inhibitor of activated STAT 1.
Target Information
Species Mouse
Target Name PIAS1
Gene Abbr. Pias1
Gene ID 56469
Full Name protein inhibitor of activated STAT 1
Alias 2900068C24Rik, Ddxbp, Ddxbp1, GB, GBP
Product Details
Description Full length Clone DNA of Mouse protein inhibitor of activated STAT 1.
NCBI Ref Seq NM_019663.3
RefSeq ORF Size 1956 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.