Online Inquiry
PDPK1 cDNA ORF Clone, Human, untagged
SPD-11300
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human 3-phosphoinositide dependent protein kinase-1. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | PDK1 |
| Gene Abbr. | PDPK1 |
| Gene ID | 5170 |
| Full Name | 3-phosphoinositide dependent protein kinase 1 |
| Alias | PDK1, PDPK2, PDPK2P, PRO0461 |
| Introduction | Phosphoinositide-dependent protein kinase 1 (PDK1) plays a central role in many signal transduction pathways including the activation of Akt and the PKC isoenzymes p70 S6 kinase and RSK. Through its effects on these kinases, PDK1 is involved in the regulation of a wide variety of processes, including cell proliferation, differentiation and apoptosis. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human 3-phosphoinositide dependent protein kinase-1. |
| NCBI Ref Seq | NM_002613.3 |
| RefSeq ORF Size | 1671 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.