Online Inquiry
NGFR cDNA ORF Clone, Human, C-His tag
SPD-10764
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human nerve growth factor receptor (TNFR superfamily, member 16) with C terminal His tag. |
Target Information | |
---|---|
Species | Human |
Target Name | NGFR |
Gene Abbr. | NGFR |
Gene ID | 4804 |
Full Name | nerve growth factor receptor |
Alias | CD271, Gp80-LNGFR, TNFRSF16, p75(NTR), p75NTR |
Introduction | Nerve growth factor receptor contains an extracellular domain containing four 40-amino acid repeats with 6 cysteine residues at conserved positions followed by a serine/threonine-rich region, a single transmembrane domain, and a 155-amino acid cytoplasmic domain. The cysteine-rich region contains the nerve growth factor binding domain. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Human nerve growth factor receptor (TNFR superfamily, member 16) with C terminal His tag. |
NCBI Ref Seq | NM_002507.2 |
RefSeq ORF Size | 1284 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.