NGFR cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

NGFR cDNA ORF Clone, Human, C-FLAG tag

NGFR cDNA ORF Clone, Human, C-FLAG tag

SPD-10763

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human nerve growth factor receptor (TNFR superfamily, member 16) with C terminal Flag tag.
Target Information
Species Human
Target Name NGFR
Gene Abbr. NGFR
Gene ID 4804
Full Name nerve growth factor receptor
Alias CD271, Gp80-LNGFR, TNFRSF16, p75(NTR), p75NTR
Introduction Nerve growth factor receptor contains an extracellular domain containing four 40-amino acid repeats with 6 cysteine residues at conserved positions followed by a serine/threonine-rich region, a single transmembrane domain, and a 155-amino acid cytoplasmic domain. The cysteine-rich region contains the nerve growth factor binding domain. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Human nerve growth factor receptor (TNFR superfamily, member 16) with C terminal Flag tag.
NCBI Ref Seq NM_002507.2
RefSeq ORF Size 1284 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6 G>A not causing the amino acid variation.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.33kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.