Ngf cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Ngf cDNA ORF Clone, Mouse, C-FLAG tag

Ngf cDNA ORF Clone, Mouse, C-FLAG tag

SPD-10753

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse nerve growth factor, transcript variant B with C terminal Flag tag.
Target Information
Species Mouse
Target Name NGF
Gene Abbr. Ngf
Gene ID 18049
Full Name nerve growth factor
Alias Ngfb, beta-NGF
Product Details
Description Full length Clone DNA of Mouse nerve growth factor, transcript variant B with C terminal Flag tag.
NCBI Ref Seq NM_001112698.1
RefSeq ORF Size 765 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Restriction Sites KpnI + NotI (6kb + 0.77kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.