Nedd4 cDNA ORF Clone, Mouse, N-Myc tag - CD BioSciences

service-banner

Nedd4 cDNA ORF Clone, Mouse, N-Myc tag

Nedd4 cDNA ORF Clone, Mouse, N-Myc tag

SPD-10617

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse neural precursor cell expressed, developmentally down-regulated 4 with N terminal Myc tag.
Target Information
Species Mouse
Target Name NEDD4
Gene Abbr. Nedd4
Gene ID 17999
Full Name neural precursor cell expressed, developmentally down-regulated 4
Alias AA959633, AL023035, AU019897, E430025J12Rik, EG639396
Introduction Neural precursor expressed, developmentally down-regulated protein 4 (NEDD4) was originally identified as a gene that is highly expressed in the early mouse embryonic central nervous system. Subsequently, a family of NEDD4-like proteins have been defined that includes seven members in humans. NEDD4 and NEDD4-like (NEDD4L) proteins contain multiple functional domains including a calcium-dependent phospholipid and membrane binding domain (C2 domain), two to four protein binding domains (WW domains), and an E3 ubiquitin-protein ligase domain (HECT domain). NEDD4 and NEDD4L have been shown to downregulate both neuronal voltage-gated Na+ channels (NaVs) and epithelial Na+ channels (ENaCs) in response to increased intracellular Na+ concentrations. The WW domains of NEDD4 bind to PY motifs (amino acid sequence PPXY) found in multiple NaV and ENaC proteins; ubiquitination of these proteins is mediated by the HECT domain of NEDD4 and results in their internalization and removal from the plasma membrane. Research studies have shown that mutation of the PY motifs in ENaC proteins is associated with Liddle's syndrome, an autosomal dominant form of hypertension. In addition to targeting sodium channels, NEDD4L has also been shown to negatively regulate TGF-β signaling by targeting Smad2 for degradation. Mouse and human NEDD4 are rapidly cleaved by caspase proteins during apoptosis, although the significance of this cleavage is not clear.
Product Details
Description Full length Clone DNA of Mouse neural precursor cell expressed, developmentally down-regulated 4 with N terminal Myc tag.
NCBI Ref Seq NM_010890.3
RefSeq ORF Size 2664 bp
Vector pCMV3-N-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.