Online Inquiry
MEF2D cDNA ORF Clone, Human, N-His tag
SPD-10220
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human myocyte enhancer factor 2D with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | MEF2D |
| Gene Abbr. | MEF2D |
| Gene ID | 4209 |
| Full Name | myocyte enhancer factor 2D |
| Introduction | Myocyte enhancer factor 2D (MEF2D) is a member of the MEF2 family of transcription factors. In mammals, there are four MEF2C-related genes (MEF2A, MEF2B, MEF2C, and MEF2D) that encode proteins that exhibit significant amino acid sequence similarity within their DNA-binding domains and, to a lesser extent, throughout the rest of the proteins. MEF2 proteins contain a highly conserved N-terminal MADS-box domain, an MEF2 domain, and a more highly variable C-terminal transactivation domain. The MEF2 family members were originally described as muscle-specific DNA-binding proteins that recognize MEF2 motifs found within the promoters of many muscle-specific genes; however, more recently they have been found to play critical roles in other physiological processes, such as heart formation and nervous system development. As such, alterations in MEF2 protein levels can result in developmental and neurological disorders, as well as other diseases such as liver fibrosis and many types of cancer. Specifically, MEF2D expression in hepatocellular carcinoma (HCC) is associated with higher levels of proliferation and poor prognosis. MEF2D is also overexpressed in clinical colorectal cancer tissues, where its high expression correlates with metastatic process. Functional investigations show that MEF2D promotes cancer cell invasion and epithelial-mesenchymal transition (EMT) and that it is essential for certain microenvironment signals to induce EMT and metastasis in vivo. Alternatively, MEF2D may function as a tumor suppressor in lipo- and leiomyosarcoma, as decreased MEF2D activity results in increased cell proliferation and anchorage-independent growth. MEF2D may also act as a tumor suppressor in rhabdomyosarcoma, as loss of MEF2D expression results in inhibition of differentiation, increased cell proliferation, and increased anchorage-independent growth. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human myocyte enhancer factor 2D with N terminal His tag. |
| NCBI Ref Seq | BC054520 |
| RefSeq ORF Size | 1566 bp |
| Vector | pCMV3-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.