Mbl1 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Mbl1 cDNA ORF Clone, Rat, untagged

Mbl1 cDNA ORF Clone, Rat, untagged

SPD-10092

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat mannose-binding lectin (protein A) 1.
Target Information
Species Rat
Target Name MBL1
Gene Abbr. Mbl1
Gene ID 24548
Full Name mannose-binding lectin (protein A) 1
Alias Mbpa, Mlb1
Product Details
Description Full length Clone DNA of Rat mannose-binding lectin (protein A) 1.
NCBI Ref Seq NM_012599.2
RefSeq ORF Size 717 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.