Online Inquiry
Max cDNA ORF Clone, Mouse, N-His tag
SPD-10068
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse Max protein with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Max |
| Gene Abbr. | Max |
| Gene ID | 17187 |
| Full Name | Max protein |
| Alias | AA960152, AI875693, bHLHd, bHLHd4, bHLHd5 |
| Introduction | Members of the Myc/Max/Mad network function as transcriptional regulators with roles in various aspects of cell behavior including proliferation, differentiation and apoptosis. These proteins share a common basic-helix-loop-helix leucine zipper (bHLH-ZIP) motif required for dimerization and DNA-binding. Max was originally discovered based on its ability to associate with c-Myc and found to be required for the ability of Myc to bind DNA and activate transcription. Subsequently, Max has been viewed as a central component of the transcriptional network, forming homodimers as well as heterodimers with other members of the Myc and Mad families. The association between Max and either Myc or Mad can have opposing effects on transcriptional regulation and cell behavior. The Mad family consists of four related proteins; Mad1, Mad2 (Mxi1), Mad3 and Mad4, and the more distantly related members of the bHLH-ZIP family, Mnt and Mga. Like Myc, the Mad proteins are tightly regulated with short half-lives. In general, Mad family members interfere with Myc-mediated processes such as proliferation, transformation and prevention of apoptosis by inhibiting transcription. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse Max protein with N terminal His tag. |
| NCBI Ref Seq | NM_001146176.1 |
| RefSeq ORF Size | 456 bp |
| Vector | pCMV3-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.