Online Inquiry
MASP1 cDNA ORF Clone, Human, untagged
SPD-10062
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor), transcript variant 2. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | MASP1 |
| Gene Abbr. | MASP1 |
| Gene ID | 5648 |
| Full Name | mannan binding lectin serine peptidase 1 |
| Alias | 3MC1, CRARF, CRARF1, MAP1, MASP |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor), transcript variant 2. |
| NCBI Ref Seq | NM_139125.2 |
| RefSeq ORF Size | 2187 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutation: 1374 T/C not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 2.19kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.