Online Inquiry
MAPT cDNA ORF Clone, Human, N-HA tag
SPD-14451
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human microtubule-associated protein tau (MAPT), transcript variant 4 with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Tau |
| Gene Abbr. | MAPT |
| Gene ID | 4137 |
| Full Name | microtubule associated protein tau |
| Alias | DDPAC, FTDP-17, MAPTL, MSTD, MTBT1 |
| Introduction | Tau is a neuronal microtubule associated protein found predominantly on axons. The function of Tau is to promote tubulin polymerisation and stabilise microtubules, but it also serves to link certain signalling pathways to the cytoskeleton. Tau, in its hyperphosphorylated form, is the major component of paired helical filaments (PHF) and neurofibrillary lesions in Alzheimer's disease (AD) brain. Hyperphosphorylation impairs the microtubule binding function of Tau, resulting in the destabilisation of microtubules in AD brains, ultimately leading to the degeneration of the affected neurons. Hyperphosphorylated tau is also found in a range of other central nervous system disorders. Numerous serine/threonine kinases, including GSK3 beta, PKA, Cdk5, and casein kinase II can phosphorylate Tau. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human microtubule-associated protein tau (MAPT), transcript variant 4 with N terminal HA tag. |
| NCBI Ref Seq | NM_016841.2 |
| RefSeq ORF Size | 1101 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + XbaI (6kb + 1.10kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.