Online Inquiry
MAPKAPK3 cDNA ORF Clone, Human, C-HA tag
SPD-10035
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human mitogen-activated protein kinase-activated protein kinase 3 with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | MAPKAPK-3 |
| Gene Abbr. | MAPKAPK3 |
| Gene ID | 7867 |
| Full Name | MAPK activated protein kinase 3 |
| Alias | 3PK, MAPKAP-K3, MAPKAP3, MAPKAPK-3, MDPT3 |
| Introduction | MAPKAPK-3 has a single potential SH3-binding site in the proline-rich amino terminus, a putative ATP-binding site, 2 MAP kinase phosphorylation site motifs, and a putative nuclear localization signal. It shares 72% nucleotide and 75% amino acid identity with MAPKAPK-2. MAPKAPK-3 has been shown to be activated by growth inducers and stress stimulation of cells. In vitro studies have demonstrated that Erk, p38 MAP kinase, and Jun amino-terminal kinase are able to phosphorylate and activate MAPKAPK-3, which suggested a role for this kinase as an integrative element of signaling in both mitogen and stress responses. MAPKAPK-3 was reported to interact with, phosphorylate, and repress the activity of E47, which is a basic helix-loop-helix transcription factor involved in the regulation of tissue-specific gene expression and cell differentiation. MAPKAPK-3 may also support luteal maturation through the phosphorylation and activation of the nuclear transcription factor CREB. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human mitogen-activated protein kinase-activated protein kinase 3 with C terminal HA tag. |
| NCBI Ref Seq | NM_004635.3 |
| RefSeq ORF Size | 1191 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + XbaI (6kb + 1.19kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.