Online Inquiry
Map3k13 cDNA ORF Clone, Mouse, N-His tag
SPD-09978
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse mitogen-activated protein kinase kinase kinase 13 with N terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | MAP3K13 |
Gene Abbr. | Map3k13 |
Gene ID | 71751 |
Full Name | mitogen-activated protein kinase kinase kinase 13 |
Alias | C130026N12Rik, LZK |
Introduction | The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq] |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse mitogen-activated protein kinase kinase kinase 13 with N terminal His tag. |
NCBI Ref Seq | NM_172821.3 |
RefSeq ORF Size | 2880 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.