MAP3K13 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

MAP3K13 cDNA ORF Clone, Human, untagged

MAP3K13 cDNA ORF Clone, Human, untagged

SPD-09991

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 13.
Target Information
Species Human
Target Name MAP3K13
Gene Abbr. MAP3K13
Gene ID 9175
Full Name mitogen-activated protein kinase kinase kinase 13
Alias LZK, MEKK13, MLK
Introduction The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq]
Product Details
Description Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 13.
NCBI Ref Seq NM_004721.3
RefSeq ORF Size 2901 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 2.9kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.