Online Inquiry
Map2k3 cDNA ORF Clone, Mouse, C-FLAG tag
SPD-10359
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 3 with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | MKK3 |
| Gene Abbr. | Map2k3 |
| Gene ID | 26397 |
| Full Name | mitogen-activated protein kinase kinase 3 |
| Alias | AW212142, MAPKK 3, MEK3, MKK3, MKK3b |
| Introduction | MKK3 and MKK6 are two closely related dual-specificity protein kinases that activate p38 MAP kinase. MKK3 and MKK6 both phosphorylate and activate p38 MAP kinase at its activation site, Thr-Gly-Tyr, but do not phosphorylate or activate Erk1/2 or SAPK/JNK. Phosphorylation of p38 MAP kinase dramatically stimulates its ability to phosphorylate protein substrates such as ATF-2 and Elk-1. MKK3 and MKK6 are both activated by different forms of cellular stress and inflammatory cytokines. Activation of MKK3 and MKK6 occurs through phosphorylation at Ser189 and Thr222 on MKK3 and Ser207 and Thr211 on MKK6.Three alternatively spliced transcript variants of MKK3 encoding distinct isoforms have been reported. Isoform B utilizes a different start codon compared to isoform C resulting in the production of a N-terminal segment of isoform B which is shorter and distinct from isoform C. MKK3b is the predominant form of MKK3 and strongly activates p38 MAP kinase (6) |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse mitogen-activated protein kinase kinase 3 with C terminal Flag tag. |
| NCBI Ref Seq | NM_008928.4 |
| RefSeq ORF Size | 1044 bp |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.