Online Inquiry
LYN cDNA ORF Clone, Human, C-HA tag
SPD-09955
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human v-yes-1 Yamaguchi sarcoma viral related oncogene homolog , transcript variant 2 with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | LYN |
| Gene Abbr. | LYN |
| Gene ID | 4067 |
| Full Name | LYN proto-oncogene, Src family tyrosine kinase |
| Alias | JTK8, p53Lyn, p56Lyn |
| Introduction | Lyn, one of the Src family members, is predominantly expressed in hematopoietic cells. Two tyrosine residues have been reported to play a crucial role in the regulation of protein tyrosine kinases of the Src family. Autophosphorylation of Tyr396 (equivalent to Tyr416 of Src), located in the catalytic domain, correlates with enzyme activation. Csk-mediated phosphorylation of the carboxy-terminal Tyr507 (equivalent to Tyr527 of Src) inactivates the kinase. Tyrosine phosphorylation and activation of Lyn occurs upon association with cell surface receptors such as the B cell Ag receptor (BCR) and CD40. Studies using knockout mice have shown that the net effect of Lyn deficiency is to render B cells hypersensitive to BCR stimulation, suggesting that the most critical role for Lyn in vivo is in the down-regulation of B cell responses. Lyn is also involved in controlling the migration and development of specific B cell populations. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human v-yes-1 Yamaguchi sarcoma viral related oncogene homolog , transcript variant 2 with C terminal HA tag. |
| NCBI Ref Seq | NM_001111097.1 |
| RefSeq ORF Size | 1476 bp |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.