Online Inquiry
LIPE cDNA ORF Clone, Human, untagged
SPD-06506
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human lipase, hormone-sensitive |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | HSL |
| Gene Abbr. | LIPE |
| Gene ID | 3991 |
| Full Name | lipase E, hormone sensitive type |
| Alias | AOMS4, FPLD6, HSL, LHS, REH |
| Introduction | HSL (hormone-sensitive lipase) catalyzes the hydrolysis of triacylglycerol, the rate-limiting step in lipolysis. Lipolytic stimuli activate adenylyl cyclase and thus increase intracellular cAMP levels, which in turn activate protein kinase A (PKA). PKA phosphorylates HSL at Ser563, Ser659, and Ser660, which stimulates HSL activity. In contrast, AMPK phosphorylates HSL at Ser565, which reduces HSL phosphorylation at Ser563 by PKA and inhibits HSL activity. Recent work indicates that phosphorylation at Ser600 by p44/42 MAPKs also enhances the enzymatic activity of HSL. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human lipase, hormone-sensitive |
| NCBI Ref Seq | NM_005357.3 |
| RefSeq ORF Size | 3231 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.