Online Inquiry
LEP cDNA ORF Clone, Human, N-HA tag
SPD-09718
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human leptin with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Leptin |
| Gene Abbr. | LEP |
| Gene ID | 3952 |
| Full Name | leptin |
| Alias | LEPD, OB, OBS |
| Introduction | Leptin, the obese (ob) gene product, is a small protein expressed in and secreted from adipose tissue of normal rodents. Studies suggest leptin acts as a circulating hormone capable of regulating body-weight homeostasis and energy balance. One possible target tissue for leptin is the hypothalamus, a proposed control center for satiety and energy expenditure. Ob gene knockout mice are characterized by several metabolic abnormalities including hyperglucocorticoidemia, hyperinsulinemia and insulin resistance, hyperglycemia, altered central nervous system activity, reduced metabolic rate of brown adipose tissue, and a large increase in white adipose tissue. Studies show that the administration of recombinant leptin to ob knockout mice reduces food intake and increases energy expenditure. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human leptin with N terminal HA tag. |
| NCBI Ref Seq | NM_000230.2 |
| RefSeq ORF Size | 504 bp |
| Vector | pCMV3-SP-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.